High-confidence human miRNAs and their cross-references

Mature miRNA	Sequence	Cross-reference
hsa-let-7a-5p	UGAGGUAGUAGGUUGUAUAGUU	search.cgi?searchType…
hsa-let-7a-5p	UGAGGUAGUAGGUUGUAUAGUU	URS0000416056_9606
hsa-let-7a-5p	UGAGGUAGUAGGUUGUAUAGUU	hsa-let-7a-5p.html
hsa-let-7a-5p	UGAGGUAGUAGGUUGUAUAGUU	linkFromMirbase.do?mi…

Run this query → no server · no download · no account

caviri.github.io/rete

Run this query in the playground → 50 rows · 395 ms · 1.0 MB of 39.2 MB read over HTTP range · no server, no download — the query runs in your browser.

The query

PREFIX mb: <https://w3id.org/rete/mirbase#> PREFIX rdfs: <http://www.w3.org/2000/01/rdf-schema#> PREFIX obo: <http://purl.obolibrary.org/obo/> SELECT ?name ?seq ?xref WHERE { ?m a mb:MatureMiRNA ; mb:highConfidence true ; rdfs:label ?name ; mb:sequence ?seq ; mb:derivesFrom/mb:organism obo:NCBITaxon_9606 . OPTIONAL { ?m rdfs:seeAlso ?xref } } LIMIT 50

rete playground · documentation · github.com/caviri/rete